Mutacja białka prionowego u libijskich Żydów z chorobą Creutzfeldta-Jakoba cd

Mutacja prion-gen-gen w Codonie 200 u libijskich Żydów z chorobą Creutzfeldta-Jakoba. W zmutowanym allelu, oznaczonym A, lizyna (Lys) jest podstawiona dla glutaminianu (Glu) w kodonie 200. Miejsce restrykcyjne SsmAI jest znoszone przez mutację. K i H pokazują pozycje starterów stosowanych do amplifikacji DNA w reakcji łańcuchowej polimerazy. Ramka do otwierania jest wskazywana przez duże, otwarte pole, nieprzetłumaczalne regiony mRNA przez węższe pole (zakreskowany obszar), a intron przez ciągłą linię. Ramka otwartego odczytu prion-białko genomowego DNA leukocytów została zamplifikowana za pomocą reakcji łańcuchowej polimerazy i termostabilnej polimerazy Taq. Zastosowane startery, H i K, były odpowiednio 5 AAGGATCCCTCAAGCTGGAAAAAGA 3 (antysensowne) i 5 AAGAATTCTCTGACATTCTCCTCTTCA 3 (sens) (Fig. 1). H i K zawierają odpowiednio linkery BamHI i EcoRI. Genomowy DNA (1,5 .g) amplifikowano w objętości reakcyjnej 100 .l z 500 ng każdego ze starterów, 10 .l buforu reakcyjnego dla reakcji łańcuchowej polimerazy (Cetus), 10 .l 2 mM roztworu nukleotydu (trifosforan deoksyadenozyny, trifosforan deoksyguanozyny, trifosforan deoksytymidyny i trifosforan deoksycytyny), 2 ul 50 mM EDTA (pH 8,0) i 2,5 jednostki polimerazy Taq. Próbkę powleczono olejem mineralnym, aby zapobiec parowaniu, a reakcje cykliczne przeprowadzono w termocyklerze DNA (Perkin-Elmer Cetus). Cykle były następujące: 94 ° C przez minutę, 50 ° C przez 30 sekund i 72 ° C przez 2 minuty 30 sekund, przez 5 cykli; następnie 94 ° C przez minutę, 55 ° C przez 30 sekund i 72 ° C przez 2 minuty 30 sekund, przez 30 cykli. Po amplifikacji produkt reakcji frakcjonowano na 4% żelu agarozowym 3: NuSieve / SeaKern i badano na obecność odpowiedniego fragmentu 864-par zasad. Ten fragment wycięto z żelu i oczyszczono za pomocą GeneClean (Bio 101) w celu sekwencjonowania. Niefrakcjonowany produkt reakcji zastosowano do hybrydyzacji oligonukleotydów specyficznych dla allelu.
Sekwencjonowanie DNA
Reakcje sekwencjonowania przeprowadzono na oczyszczonych na żelu produktach reakcji łańcuchowej polimerazy, zgodnie z metodą dideoksy Sangera i zestawu do sekwencjonowania Seąuenase DeazaG (US Biochemical). Dwuniciowe matrycowe DNA denaturowano w 98 ° C przez osiem minut w obecności startera przed wydłużeniem łańcucha. Cztery primery stosowane do sekwencjonowania ramki odczytu białka prionowego były KH02, 5 CAGGGCAGCCCTGGAGGCAA 3 (sens); KH03, 5 AAGGAGGTGGCACCCACAGT 3 (sens); KH06, 5 TCCCTCAAGCTGGAAAAAGA 3 (antysensowny); i KH07, 5 CTCTGACATTCTCCTCTTCA 3 (sens). Ilość DNA użytego w reakcji wynosiła 100 ng, z 60 ng starterów KH03 i KH06 i 120 ng starterów K.H02 i KH07.
Hybrydyzacja oligonukleotydów swoistych dla alleli
DNA w 20 ptl produktu reakcji łańcuchowej polimerazy denaturowano w 180 .l roztworu TRIS-EDTA (pH 8,0) i 20 .l 3 N wodorotlenku sodu w temperaturze pokojowej przez 10 minut. Po zobojętnieniu 200 .l 2 M octanu amonu, DNA unieruchomiono na filtrach nitrocelulozowych z urządzeniem typu slot-blot lub dot-blot. Zduplikowane filtry zanurzone w roztworze do hybrydyzacji (3 x SSPE [440 mM chlorek sodu, 32 mM fosforan sodu, 3 mM EDTA], 5 x roztwór Denhardta, 0,5 procentowy dodecylosiarczan sodu i 500 mg ściętego DNA plemników łososia na mililitr) sondowano przez jedną godzinę w 42 ° C za pomocą dowolnej z dwóch sond 15mer typu dzikiego, oznaczonych jako HUE200, 5 AACTTCACCGAGACC3 i HU2E200, 5 GGTCTCGGTGAAGT3 , oraz ze zmutowaną sondą HUK200, 5 GGTCTTGGTGAAGTT3 , znakowaną radioaktywnie za pomocą 32P, z użyciem kinazy polinukleotydowej T4
[więcej w: mrukmed, medyk rzeszów rejestracja, transport gazów oddechowych ]